brooke09
brooke09
04-10-2017
Biology
contestada
The final stable state of a succession is called the
Respuesta :
kayleerocio
kayleerocio
04-10-2017
The final stable state of a succession is called the climax community. It most often consists of tall, thick forests.
Answer Link
VER TODAS LAS RESPUESTAS ( 86+ )
Otras preguntas
which item below is part of the circulatory system a. kidneysb. lungsc. heart or d. stomach
Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose
HELP FAST!!!! Solve the compound inequality, showing your work. Name the solution set and then draw the graph of the solution set. x-3≤-7 or x-3≥1
A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th
Joseph and cleoma, who made the first cajun recording, were husband and wife
Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as:
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
What nursing actions best promote communication when obtaining a nursing history? select all that apply?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The introduction of the Green Revolution in India was intended to
